skip to Main Content

Des professionnel-les à votre écoute

Consultation et développement d'études moléculaires

Nous offrons un service de consultation et de développement de projet personnalisé
Veuillez nous contacter pour plus d’informations.

Steven Kembel, PhD
Co-Responsable

Catherine Laprise, PhD
Co-Responsable

Geneviève Bourret, MSc
Professionnelle de recherche

La plateforme de génomique est équipé d’un séquenceur Illumina MiSeq pour répondre à vos projets de :

  • Séquençage d’amplicons (ex : 16S, ITS, barcoding, etc)
  • Séquençage de petits génomes
  • Séquençage de métagénomes (annotations, assemblage)
  • Séquençage d’ARN 3’ mRNA seq kit pour des études de profiling)
  • Séquençage de librairies prêtes à être séquencées

Pour plus de détails sur les possibilités de séquençage, veuillez svp consulter la section préparation de librairies.

Préparation des échantillons, Préparation des librairies

Préparations des échantillons

Extraction, quantification, et analyse de la qualité de l’ADN issus des échantillons fournis.  Dû à la nature très variée des différents types d’échantillons, veuillez-nous contacter pour discuter de votre projet.

Agilent 2100 Bioanalyzer
  • Mesure la taille de fragments de 50-7000bp avec une précision de ±10%
  • Quantifie de 0.5-500pg/µl avec une précision de 20%
Fluorimètre QUBIT
  • Quantification de l’ADN et de l’ARN dans un même échantillon
  • Quantification de l’ADN : 10pg/µL – 1µg/µL
  • Volume nécessaire : 1 µL
Nanodrop ONE
  • Quantification de l’ADN, de l’ARN, et des protéines
  • Quantification de l’ADN : 2 ng/μl – 27.5 μg/μl
  • Détection de contaminants (phénol, protéines)
  • Volume nécessaire : 1 µL

Préparation de librairies d’amplicons (16S, ITS, etc…)

Le service de préparation de librairies d’amplicons inclut les PCR, la préparation de la librairie et le séquençage Miseq (kit V3, 600 cycles). Les amplicons seront multiplexés (jusqu’à 384 échantillons par Miseq, incluant les contrôles positif et négatif).  Vous obtiendrez une lecture d’environ 30 000 reads/échantillon.  Si vous désirez une profondeur de séquençage plus élevée (moins d’échantillons par Miseq) veuillez nous contacter avant de soumettre vos échantillons, des frais supplémentaires peuvent être appliqués.

Il est également possible d’avoir recours au service de préparation des librairies sans séquençage.  Dans ce cas, veuillez nous contacter.

La plateforme fournit les amorces pour l’amplification 16S et ITS (voir plus bas les paires d’amorces disponibles).  Ces amorces contiennent les adaptateurs d’Illumina nécessaires au séquençage, les index qui permettent le multiplexage des échantillons et la séquence spécifique d’amplification.  Il est aussi possible de commander des amorces personnalisées (frais supplémentaires applicables) si celles-ci ne figurent pas sur la liste.

Liste des amorces

  • Amorce sens 799F (séquence 5’->3’) : AACMGGATTAGATACCCKG
  • Amorce anti-sens 1115R (séquence 5’->3’) : AGGGTTGCGCTCGTTG
  • Amorce sens 515F (séquence 5’->3’) :  GTGYCAGCMGCCGCGGTAA (Parada et al. 2015)*
  • Amorce anti-sens 926R (séquence 5’->3’) :  CCGYCAATTYMTTTRAGTTT

*Noter que les amorces V4-V5 amplifient aussi le 18S.  Cette paire d’amorces n’est donc pas recommandée pour les échantillons contenant une contamination substantielle avec de l’ADN de l’hôte (Parada et al. 2015).

  • Amorce sens ITS1F (séquence 5’->3’) :  CTTGGTCATTTAGAGGAAGTAA
  • Amorce anti-sens ITS2 (séquence 5’->3’) :  GCTGCGTTCTTCATCGATGC

Il est possible de commander des amorces personnalisées pour s’adapter à vos besoins (frais supplémentaires applicables).

Tarifs

Les membres du CERMO-FC et les chercheur.es de l’UQAM sont invités à nous contacter pour connaître les tarifs privilèges grâce au support du CERMO-FC.

PCR et séquençage Miseq v3, 600 cycles*

  • <376 échantillons : 21$/échantillon
  • >376 échantillons : 19$/échantillon

*Des frais supplémentaires sont applicables pour des amorces personnalisées. Consulter la section préparation de librairie d’amplicons pour connaitre les séquences d’amorces fournies par la plateforme.

PCR et séquencage Miseq v3, 600 cycles*

  • <376 échantillons : 26,25$/échantillon
  • >376 échantillons : 24,15$/échantillon

*Des frais supplémentaires sont applicables pour des amorces personnalisées. Consulter la section préparation de librairie d’amplicons pour connaitre les séquences d’amorces fournies par la plateforme.

Des frais administratifs de 15% peuvent être applicables.

Autres types de librairies

Librairies d’ADN shotgun

Il est possible de réaliser des librairies d’ADN de type shotgun avec ou sans PCR, préparées à l’aide du kit QIAseq FX DNA de Qiagen.  Les librairies produites sont compatibles avec n’importe quel séquenceur Illumina.

  • jusqu’à 96 index disponibles
  • quantité d’ADN de départ flexible
  • l’ADN fournit doit être de bonne qualité (sans traces résiduelle de protéines, sans sels ou autres contaminants) et éluée dans de l’eau ou un tampon exempt d’EDTA.

Librairies d’ARN

Il est possible de vous offrir un service de préparation de librairies d’ARN, avec en amont la possibilité d’enrichir les ARNm ou dépléter les ARNr. Ces librairies sont compatibles avec n’importe quel séquenceur Illumina.

Pour des études de profiling nous pouvons produire des librairies 3’ mRNA seq qui nécessitent moins de reads par échantillon qu’un RNA-seq régulier.

Pour tout projet avec l’ARN, veuillez contacter la plateforme avant de soumettre vos échantillons.

Service de barcoding d'amplicons

384 combinaisons d’index disponibles, adaptateur Nextera

Le service de barcoding permet le séquençage simultané d’un grand nombre d’échantillons (jusqu’à 384) sur un Miseq.  Le multiplexage d’échantillons peut être utile lorsque l’on cible plusieurs régions spécifiques d’un génome.  Des index ou barcodes individuels sont ajoutés à chaque échantillon par PCR durant la préparation de la librairie pour le séquençage de nouvelle génération (NGS).  Les barcodes sont ensuite utilisés pour démultiplexer ou différencier les reads de chacun des échantillons.  Ce service est différent du service de préparation de librairie d’amplicons puisqu’il comporte deux étapes de PCR :

  1. L’amplification spécifique des régions d’intérêts est réalisée par le client.
  2. L’étape de barcoding est effectuée par la plateforme de génomique du CERMO-FC.

Vous devez alors nous fournir des amplicons contenant les adaptateurs Nextera d’Illumina afin que nous puissions faire l’étape du barcoding.  Voici les adaptateurs à ajouter à vos amorces spécifiques :

  • Adaptateur amorce sens (5’->3’) : TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
  • Adaptateur amorce anti-sens (5’->3’) : GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Ce service inclut le barcoding, la préparation de la librairie et le séquençage Miseq (kit V3, 600 cycles).  Les amplicons seront multiplexés (jusqu’à 384 échantillons par Miseq, incluant les contrôles positifs et négatifs).  Vous aurez une lecture d’environ 30 000 reads/échantillon.  Si vous désirez une profondeur de séquençage plus élevée (moins d’échantillons par Miseq) veuillez nous contacter avant de soumettre vos échantillons, des frais supplémentaires peuvent être appliqués.

Il est également possible d’avoir recours au service de préparation des librairies sans séquençage.  Dans ce cas, veuillez nous contacter.

Tarifs

Les membres du CERMO-FC et les chercheur.es de l’UQAM sont invités à nous contacter pour connaître les tarifs privilèges grâce au support du CERMO-FC.

Barcoding et séquençage Miseq v3, 600 cycles*

  • <376 échantillons : 21$/échantillon
  • >376 échantillons : 19$/échantillon

*Des frais supplémentaires sont applicables pour des amorces personnalisées. Consulter la section préparation de librairie d’amplicons pour connaitre les séquences d’amorces fournies par la plateforme.

Barcoding et séquençage Miseq v3, 600 cycles*

  • <376 échantillons : 26,25$/échantillon
  • >376 échantillons : 24,15$/échantillon

*Des frais supplémentaires sont applicables pour des amorces personnalisées. Consulter la section préparation de librairie d’amplicons pour connaitre les séquences d’amorces fournies par la plateforme.

Des frais administratifs de 15% peuvent être applicables.

Génotypage d'animaux

La plateforme de génomique offre un service de génotypage de vos animaux.

Le service de génotypage comprend l’extraction de l’ADN (méthode HotSHOT) à partir d’un poinçon d’oreille de souris, une réaction de PCR et la production d’un rapport de résultats.
Vous désirez génotyper d’autres types d’animaux ? Veuillez svp nous contacter.

Les résultats de génotypage de souris sont habituellement livrés dans un délai de 48-72 heures suivant la réception des échantillons.
Vous avez un délai précis à respecter ? Veuillez svp nous contacter.

Tarifs

Les membres du CERMO-FC et les chercheur.es de l’UQAM sont invités à nous contacter pour connaître les tarifs privilèges grâce au support du CERMO-FC.

Le génotypage est au coût de 2,65$/échantillon. Des frais supplémentaires peuvent être appliqués pour l’obtention de résultat en accéléré. Veuillez svp contacter la plateforme pour plus d’informations.

Le génotypage est au coût de 3,15$/échantillon.
Des frais supplémentaires peuvent être appliqués pour l’obtention de résultat en accéléré. Veuillez svp contacter la plateforme pour plus d’informations.

Des frais administratifs de 15% peuvent être applicables.

Recommandations

Je suis très contente avec le niveau du soutien technique et la qualité des données produit par la plateforme de génomique du CERMO-FC. Geneviève était très généreuse avec ses conseils qu’elle a donnés aux étudiants concernant la préparation de leurs échantillons, le contrôle de qualité en termes de techniques, et les estima des coûts pour leurs projets.

Publications issues de l’analyse des échantillons par la plateforme du CERMO-FC

FAQ - Foire aux questions

Général

Oui. Les chercheur.es du réseau des Universités du Québec et les membres du CERMO-FC sont invités à nous contacter pour connaître les tarifs privilèges grâce au support du CERMO-FC.

Contactez-nous, nous vous ferons parvenir le formulaire de soumission des échantillons adapté à votre projet.

Vous pouvez venir porter vos échantillons en personne à l’adresse ci-dessous. Il est conseillé d’annoncer votre visite au préalable afin de s’assurer la présence d’une personne pour la réception de vos échantillons.
**Non disponible jusqu’à nouvel ordre en raison de la pandémie COVID19

Plateforme de génomique CERMO-FC
Pavillon des sciences biologiques UQAM SB-2130
141 avenue du Président-Kennedy
Montréal (Québec)
H2X 1Y4

Vous pouvez également faire livrer vos échantillons par un transporteur à l’adresse ci-dessous. Le transport des échantillons se fait aux frais du demandeur. La plateforme de génomique du CERMO-FC n’est pas responsable des dommages ou pertes des échantillons occasionnés lors du transport.

Plateforme de génomique CERMO-FC
Quai de réception PK, UQAM SB-2130
2005 rue Jeanne-Mance
Montréal (Québec)
H2X 2J6

Oui. La plateforme travaille continuellement sur l’élaboration de nouveaux protocoles et de nouveaux services à offrir. N’hésitez pas à nous contacter pour discuter de votre projet de génomique même si celui-ci ne figure pas sur la liste des services offerts.

Séquençage

-Il est recommandé de n’envoyer qu’un aliquot des échantillons à analyser.

-L’utilisateur doit aussi s’assurer que les tubes et/ou les plaques sont correctement scellés afin d’éviter l’évaporation et la contamination croisée entre les échantillons lors du transport.

-Il est aussi recommandé de bien identifier les tubes et/ou plaques contenant les échantillons et de
joindre le formulaire de soumission des échantillons avec ceux-ci.

-Les échantillons d’ARN et les tissus doivent être impérativement envoyés sur glace sèche. La glace sèche est aussi recommandée pour l’envoi des échantillons d’ADN.

-En cas de doute, communiquez avec nous avant l’envoi de vos échantillons.

-Suite à la réception des échantillons, un test de qualité est effectué sur ceux-ci. L’utilisateur sera
contacté en cas de problème.

Oui. Suite à la réception des échantillons, un test de qualité est effectué. La non-conformité des échantillons peut occasionner un délai et/ou des frais supplémentaires (ex. optimisation des
protocoles, quantification des échantillons, purification des échantillons, etc.). L’utilisateur sera contacté en cas de problème.

La longueur de lecture fait référence au nombre de paires de base (pb) séquencées à partir d’un fragment d’ADN. Le Miseq permet jusqu’à 2 x 300 pb en lecture pairée (paired-end) ou 600 cycles de
séquençage.

Le séquençage d’un génome implique le séquençage unique de chaque base de ce génome. Toutefois, afin d’être confiant dans le processus d’assignation des bases, la plupart des applications nécessitent que le séquençage de chaque base soit effectué plusieurs fois. La couverture de séquençage (ou profondeur de séquençage) réfère donc au nombre de fois où une base de référence est représentée dans un ensemble de lectures de séquençage.

Avant de commencer une expérience de séquençage, vous devez connaître la profondeur de séquençage que vous souhaitez atteindre. La plupart des utilisateurs déterminent le niveau de
couverture nécessaire en fonction du type d’étude, du niveau d’expression des gènes, de la taille du génome, de la littérature publiée dans le domaine d’étude et des meilleures pratiques définies par la communauté scientifique. Illumina n’a pas de recommandation officielle pour le niveau de couverture de séquençage, mais propose deux outils intéressants :
Bulletin : Estimating Sequencing Coverage
Outil pour calculer la couverture de séquençage

Les délais pour obtenir les résultats de séquençage dépendent du volume d’échantillons à traiter et du type d’analyse demander.
Vous avez un délai précis à respecter ? Contactez-nous avant la soumission de votre projet

Les données de séquençage obtenues seront démultiplexées et livrées sous le format FASTQ. Pour le séquençage en lecture seule (single-read), un seul fichier FATSQ sera créé par échantillon (R1). Pour une analyse pairée (paired-end), deux fichiers FASTQ seront créés par échantillon (R1 et R2). Pour plus d’informations sur les fichiers FASTQ consultez le bulletin d’Illumina suivant : FASTQ files explained

Génotypage

Le service de génotypage comprend l’extraction de l’ADN à partir d’un poinçon d’oreille de souris, une réaction de PCR et la production d’un rapport de résultats.

L’extraction de l’ADN se fait à partir d’une lyse avec du NaOH (méthode HotSHOT).
Référence : BioTechniques 29:52-54 (July 2000)

Les résultats de génotypage de souris sont habituellement livrés dans un délai de 48-72 heures suivant la réception des échantillons.
Vous avez un délai précis à respecter ? Contactez-nous

Back To Top