Bienvenue sur la plateforme Génomique

Pour vous familiariser avec les procédures et le fonctionnement de la plateforme nous vous suggérons de consulter le  Guide utilisateur  de la plateforme et/ou vous reporter à notre foire aux questions -FAQ-.

Pour faire une demande de services veuillez cliquer ici.

Pour plus d’informations n’hésitez pas à communiquer avec nous:  Contact Génomique

Services

Extraction et quantification de l’ADN issus des échantillons fournis.  Dû à la nature très variée des différents types d’échantillons, veuillez-nous contacter pour discuter de votre projet.

16S, ITS, etc…

Le service de préparation de librairies d’amplicons inclut les PCR, la préparation de la librairie et le séquençage Miseq (kit V3, 600 cycles).  Les amplicons seront multiplexés (jusqu’à 384 échantillons par Miseq, incluant les contrôles positif et négatif).  Vous obtiendrez une lecture d’environ 30 000 reads/échantillon.  Si vous désirez une profondeur de séquençage plus élevée (moins d’échantillons par Miseq) veuillez nous contacter avant de soumettre vos échantillons, des frais supplémentaires peuvent être appliqués.

Il est également possible d’avoir recours au service de préparation des librairies sans séquençage.  Dans ce cas, veuillez nous contacter.

La plateforme fournit les amorces pour l’amplification 16S et ITS (voir plus bas les paires d’amorces disponibles).  Ces amorces contiennent les adaptateurs d’Illumina nécessaires au séquençage, les indexes qui permettent le multiplexage des échantillons et la séquence spécifique d’amplification.  Il est aussi possible de commander des amorces personnalisées (frais supplémentaires applicables) si celles-ci ne figurent pas sur la liste.

Modifier
Région Amorce sens : séquence 5’->3’ Amorce anti-sens : séquence 5’->3’
16S V5-V6 (Bactéries, excluant les cyanobactéries) 799F AACMGGATTAGATACCCKG 1115R AGGGTTGCGCTCGTTG
16S V4-V5* (Universelles Bactéries+Archées) 515F GTGYCAGCMGCCGCGGTAA
(Parada et al. 2015)*
926R CCGYCAATTYMTTTRAGTTT
ITS1 (Fungi) ITS1F CTTGGTCATTTAGAGGAAGTAA ITS2 GCTGCGTTCTTCATCGATGC

* Noter que les amorces V4-V5 amplifient aussi le 18S.  Cette paire d’amorces n’est donc pas recommandée pour les échantillons contenant une contamination substantielle avec de l’ADN de l’hôte (Parada et al. 2015).

384 combinaisons d’index disponibles, adaptateur Nextera

Le service de barcoding permet le séquençage simultané d’un grand nombre d’échantillons (jusqu’à 384) sur un Miseq.  Le multiplexage d’échantillons peut être utile lorsque l’on cible plusieurs régions spécifiques d’un génome.  Des indexes ou barcodes individuels sont ajoutés à chaque échantillon par PCR durant la préparation de la librairie pour le séquençage de nouvelle génération (NGS).  Les barcodes sont ensuite utilisés pour démultiplexer ou différencier les reads de chacun des échantillons.  Ce service est différent du service de préparation de librairie d’amplicons puisqu’il comporte deux étapes de PCR :

  1. L’amplification spécifique des régions d’intérêts est réalisée par le client.
  2. L’étape de barcoding est effectuée par la plateforme de génomique du CERMO-FC.

Vous devez alors nous fournir des amplicons contenant les adaptateurs Nextera d’Illumina afin que nous puissions faire l’étape du barcoding.  Voici les adaptateurs à ajouter à vos amorces spécifiques :

Adaptateur amorce sens (5’->3’)
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Adaptateur amorce anti-sens (5’->3’)
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

 

Ce service inclut le barcoding, la préparation de la librairie et le séquençage Miseq (kit V3, 600 cycles).  Les amplicons seront multiplexés (jusqu’à 384 échantillons par Miseq, incluant les contrôles positifs et négatifs).  Vous aurez une lecture d’environ 30 000 reads/échantillon.  Si vous désirez une profondeur de séquençage plus élevée (moins d’échantillons par Miseq) veuillez nous contacter avant de soumettre vos échantillons, des frais supplémentaires peuvent être appliqués.

Il est également possible d’avoir recours au service de préparation des librairies sans séquençage.  Dans ce cas, veuillez nous contacter.

Préparation de librairies d’ADN de type shotgun avec ou sans PCR à l’aide du kit QIAseq FX DNA de Qiagen.  Les librairies produites sont compatibles avec n’importe quel séquenceur Illumina.  Jusqu’à 96 index disponibles.  Quantité d’ADN de départ flexible.  L’ADN fournit doit être de bonne qualité (sans traces résiduelle de protéines, sans sels ou autres contaminants) et éluée dans de l’eau ou un tampon exempt d’EDTA.

La plateforme de génomique offre un service de préparation de librairies d’ARN.  Il est possible de faire un enrichissement des ARNm ou une déplétion des ARNr avant la préparation des librairies. Ces librairies sont compatibles avec n’importe quel séquenceur Illumina.

Pour des études de profiling nous pouvons produire des librairies 3’ mRNA seq qui nécessitent moins de reads/échantillon qu’un RNA-seq régulier.

Pour tout projet avec l’ARN, veuillez contacter la plateforme avant de soumettre vos échantillons.

La plateforme de génomique offre un service de génotypage de vos animaux, veuillez contacter la plateforme pour plus d’informations.

La plateforme de génomique offre un service de consultation et de développement des études moléculaires, veuillez contacter la plateforme pour plus d’informations.

Instruments

Illumina MiSeq

  • Séquençage d’amplicons (ex : 16S, ITS, barcoding, etc)
  • Séquençage de petits génomes
  • Séquençage de métagénomes (annotations, assemblage)
  • Séquençage d’ARN 3’ mRNA seq kit pour des études de profiling)
  • Séquençage de librairies prêtes à être séquencées

Pour plus amples informations, veuillez contacter la plateforme.

Agilent 2100 Bioanalyzer

  • Mesure la taille de fragments de 50-7000bp
  • Avec une précision de ±10%
  • Quantifie de 0.5-500pg/µl
  • Avec une précision de 20%


Fluorimètre QUBIT

  • Quantification de l’ADN et de l’ARN dans un même échantillon
  • Quantification de l’ADN : 10pg/µL – 1µg/µL
  • Volume nécessaire : 1 µL


Nanodrop ONE

  • Quantification de l’ADN, de l’ARN, et des protéines
  • Quantification de l’ADN : 2 ng/μl – 27.5 μg/μl
  • Détection de contaminants (phénol, protéines)
  • Volume nécessaire : 1 µL

Tarifs

 
  <376 échantillons >376 échantillons
PCR et séquencage Miseq v3, 600 cycles* 25$/échantillon 23$/échantillon
Barcoding et séquencage Miseq v3, 600 cycles 25$/échantillon 23$/échantillon
Génotypage. Régulier 3$/échantillon

*Consulter la section préparation de librairie d’amplicons pour connaitre les séquences d’amorces fournies par la plateforme. Des frais supplémentaires sont applicables pour des amorces personnalisées.

Des frais administratifs de 15% sont à prévoir en suppléments.

Tarifs préférentiels pour les chercheur.es du secteur académique.

Modifier
  <376 échantillons >376 échantillons
PCR et séquençage Miseq v3, 600 cycles* 20$/échantillon 18$/échantillon
Barcoding et séquençage Miseq v3, 600 cycles* 20$/échantillon 18$/échantillon
Génotypage régulier 2,5$/échantillon

*Consulter la section préparation de librairie d’amplicons pour connaitre les séquences d’amorces fournies par la plateforme. Des frais supplémentaires sont applicables pour des amorces personnalisées.

Les membres du CERMO-FC et les chercheur.es de l’UQAM sont invités à nous contacter pour connaître les tarifs privilèges grâce au support du CERMO-FC.