Professionals at your service
Consulting and development of molecular studies
We offer a personalized project development and consultation service
Please contact us for more information.

Steven Kembel, PhD
Director

Geneviève Bourret, MSc
Manager
The genomics platform offers you different sequencing options to best adapt to your project, whether through our on-site equipment or through our turnkey services in collaboration with our partners.
Illumina Sequencer - NextSeq 2000 New
Expand your capabilities. Achieve 1.8 billion single-end reads per run for your most data-intensive applications.
- Amplicon sequencing (ex: 16S, ITS, barcoding, etc.)
- Small genome sequencing
- Metagenome sequencing (annotations, assembly)
- Sequencing of 3′ mRNA (profiling studies)
- Sequencing of libraries ready to be sequenced
For more details on the sequencing possibilities, please consult the library preparation section.
Oxford Nanopore technologies Sequencer – MinION
Provides up to 48 GB readout, making it ideal for sequencing small genomes and targeted applications such as:

- Bacterial metagenome
- Bacterial isolate
- Whole bacterial genomes/exomes
- Viral amplicon
- Full-length 16s rRNA
- Whole transcriptome (cDNA)
- Smaller transcriptomes (direct RNA)
- Multiplexing for smaller sample sizes
Preparation of samples
Cell isolation, extraction, quantification, and analysis of the quality of DNA from the samples provided. Our personalized services performed by our expert will ensure reproducibility of your results. Due to the very varied nature of the different types of samples, please contact us to discuss your project.
Chromium Single cell – 10X Genomics
Turnkey service for single cell analysis from library preparation to sequencing. On request, bioinformatics analysis is available through our platform.
- Obtain higher quality libraries that can be sequenced at lower depths
- Improved detection of difficult cell types, including neutrophils
- Identify rare cell types and detect rare transcripts
- Profile fresh, frozen, and fixed samples, even FFPE

QIAcube
Fully automated, spin-column based nucleic acid extraction ensuring reproducibility of your results.
- Automates 80+ QIAGEN kits with 140+ standard protocols for processing DNA, RNA, and protein samples
- Optional protocol customization extends usage to 3,000+ protocols

TapeStation 4200
- Automated high-throughput analysis (up to 96 samples) of DNA and RNA for next-generation sequencing (NGS), biobanking or vaccine development.
Volume required: 1 to 2µL

Fluorimeter QUBIT
- Quantification of DNA and RNA in the same sample
- DNA quantification: 10pg/µL – 1µg/µL
- Volume required: 1µL

Nanodrop ONE
- Quantification of DNA, RNA, and Proteins
- DNA quantification: 2ng /μl – 27.5μg /μl
- Detection of contaminants (phenol, proteins)
- Volume required: 1µL

Preparation of amplicon libraries (16S, ITS, etc ...)
The Amplicon Library Preparation Service includes PCR, library preparation and Miseq sequencing (V3 kit, 600 cycles). Amplicon will be multiplexed (up to 384 samples per Miseq, including positive and negative controls). You will get a reading of approximately 30,000 reads /sample. If you require a higher sequencing depth (fewer samples per Miseq) please contact us before submitting your samples, additional charges may apply.
It is also possible to use the library preparation service without sequencing. In this case, please contact us.
The platform provides the primers for 16S and ITS amplification (see below for available primer pairs). These primers contain the Illumina adapters needed for sequencing, the indexes that allow multiplexing of the samples, and the specific amplification sequence. It is also possible to order custom primers (additional charges apply) if they are not on the list.
List of primers:
- Forward primer 799F (séquence 5’->3’) : AACMGGATTAGATACCCKG
- Reverse primer 1115R (séquence 5’->3’) : AGGGTTGCGCTCGTTG
- Forward primer 515F (séquence 5’->3’) : GTGYCAGCMGCCGCGGTAA (Parada et al. 2015)*
- Reverse primer 926R (séquence 5’->3’) : CCGYCAATTYMTTTRAGTTT
*V4-V5 primers also amplify 18S. This primer pair is therefore not recommended for samples containing substantial contamination with host DNA (Parada et al. 2015).
- Forward primer ITS1F (séquence 5’->3’) : CTTGGTCATTTAGAGGAAGTAA
- Reverse primer ITS2 (séquence 5’->3’) : GCTGCGTTCTTCATCGATGC
Custom primers can be ordered to suit your needs (additional charges apply).
Pricing
CERMO-FC members and UQ network researchers are invited to contact us to find out about privileged pricing thanks to the support of CERMO-FC.
PCR and Miseq v3 sequencing, 600 cycles*
- <376 samples: $21 /sample
- >376 samples: $19 /sample
*Additional charges apply for custom primers. Consult the amplicon library preparation section to know the primer sequences provided by the platform.
PCR and Miseq v3 sequencing, 600 cycles *
- <376 samples: $26,25 /sample
- >376 samples: $24,15 /sample
* Additional charges apply for custom primers. Consult the amplicon library preparation section to know the primer sequences provided by the platform.
An administrative charge of 15% may be applicable.
Others types of libraries
Shotgun DNA Libraries
Turnkey service for the preparation of your libraries and sequencing. Shotgun DNA libraries with or without PCR are prepared using the NEBNext Ultra II DNA kit and are compatible with any Illumina sequencer. On request, bioinformatics analysis is available through our platform.
- up to 96 indexes available
- flexible starting amount of DNA
- the DNA provided must be of good quality (with no residual traces of protein, salts or other contaminants) and eluted in water or an EDTA-free buffer.
RNA libraries
It is possible to offer you an RNA library preparation service, with the upstream possibility of enriching the mRNAs or depleting the rRNAs. These libraries are compatible with any Illumina sequencer. On request, bioinformatics analysis is available through our platform.
For profiling studies we can produce 3 ’mRNA seq libraries which require fewer reads / sample than a regular RNA-seq.
For any project with RNA, please contact the platform before submitting your samples.
384 index combinations available, Nextera adapter
The barcoding service allows simultaneous sequencing of a large number of samples on a Miseq (up to 384). Multiplexing of samples can be useful when targeting several specific regions of a genome. Individual indexes or barcodes are added to each sample by PCR during library preparation for Next Generation Sequencing (NGS). The barcodes are then used to demultiplex or differentiate the reads of each of the samples. This service is different from the Amplicon Library Preparation Service since it has two PCR steps:
- The specific amplification of regions of interest is carried out by the client.
- The barcoding step is performed by the CERMO-FC genomics platform.
You must then provide us with amplicon containing the Illumina Nextera adapters so that we can do the barcoding. Here are the adapters to add to your specific primers:
Foward primer adapter (5 ’-> 3’): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
reverse primer adapter (5 ’-> 3’): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
This service includes barcoding, library preparation and Miseq sequencing (V3 kit, 600 cycles). Amplicon will be multiplexed (up to 384 samples per Miseq, including positive and negative controls). You will have a reading of around 30,000 reads /sample. If you require a higher sequencing depth (fewer samples per Miseq) please contact us before submitting your samples, additional charges may apply.
It is also possible to use the library preparation service without sequencing. In this case, please contact us.
CERMO-FC members and UQ network researchers are invited to contact us to find out about privileged rates thanks to the support of CERMO-FC.
Barcoding and Miseq v3 sequencing, 600 cycles *
- <376 samples: $21 /sample
- >376 samples: $19 /sample
* Additional charges apply for custom primers. Consult the amplicon library preparation section to know the primer sequences provided by the platform.
Barcoding and Miseq v3 sequencing, 600 cycles *
- <376 samples: $ 26,25 / sample
- >376 samples: $ 24,15 / sample
*Additional charges apply for custom primers. Consult the amplicon library preparation section to know the primer sequences provided by the platform.
An administrative charge of 15% may be applicable.
The genomics platform offers a service for genotyping your animals.
The genotyping service includes extracting DNA (HotSHOT method) from a mouse ear punch, PCR reaction, and producing a results report.
Do you want to genotype other types of animals? Please contact us.
Mouse genotyping results are usually delivered within 48-72 hours of receipt of samples.
Do you have a specific deadline to meet? Please contact us.
CERMO-FC members and UQ network researchers are invited to contact us to find out about privileged rates thanks to the support of CERMO-FC.
Genotyping is at a cost of $2.65 /sample. Additional fees may be applied for obtaining accelerated results. Please contact the platform for more information.
Genotyping is at a cost of $3,15 /sample.
Additional fees may be applied for obtaining accelerated results. Please contact the platform for more information.
An administrative charge of 15% may be applicable.
Recommendations
I am very happy with the level of technical support and the quality of data produced by the CERMO-FC genomics platform. Genevieve was very generous with her advice she gave to the students regarding the preparation of their samples, quality control in terms of techniques, and estimated costs for their projects.

Publications resulting from samples analysis by the CERMO-FC platform
FAQ - Frequently Ask Questions
General
Yes. Researchers from the Universités du Québec network and members of CERMO-FC are invited to contact us for the special rates through the support of CERMO-FC.
Please complete an online service request, or contact us
Contact us, we will send you the sample submission form adapted to your project.
You can bring your samples in person at the address below. It is recommended to announce your visit in advance to ensure the presence of someone to receive your samples.
** Not available until further notice due to the COVID19 pandemic
Plateforme de génomique CERMO-FC
Pavillon des sciences biologiques UQAM SB-2130
141 avenue du Président-Kennedy
Montréal (Québec)
H2X 1Y4
You can also have your samples delivered by a carrier to the address below. The transport of samples is at the expense of the applicant. The CERMO-FC genomics platform is not responsible for damage or loss of samples during transport.
Plateforme de génomique CERMO-FC
Quai de réception PK, UQAM SB-2130
2005 rue Jeanne-Mance
Montréal (Québec)
H2X 2J6
Yes. The platform is continually working on developing new protocols and new services to offer. Please do not hesitate to contact us to discuss your genomics project even if it is not on the list of services offered.
Sequencing
-It is recommended to send only an aliquot of the samples.
-To avoid evaporation and cross-contamination between samples during transport, be sure that all tubes and / or plates are properly sealed
– All tubes and / or plates should be clearly identified. Do not forget to attach the associated sample submission.
-RNA and DNA samples as well as tissues should be sent on dry ice.
If you have any doubt, please contact us before sending your samples.
Received samples will go under a quality control test. If any problems, the user will be contacted.
Yes. After receiving the samples, a quality control is carried out. Non-compliance of samples may cause delay and/or additional costs (e.g. optimization of protocols, quantification of samples, purification of samples, etc.). The user will be contacted in the event of a problem.
Reading length refers to the number of base pairs (bp) sequenced from a DNA fragment. The Miseq allows up to 2 x 300 bp in paired-end read or 600 cycles of sequencing.
Genome sequencing requires for each base a unique sequencing. However for most applications, to have an accurate base assignment process, each base needs to be sequenced several times. Next-generation sequencing (NGS) coverage describes the average number of reads that align to, or “cover,” known reference bases
Before you begin an experiment involving next-generation sequencing, you need to know the depth of sequencing you want to achieve. Most users determine the necessary coverage level based on the type of study, gene expression level, size of reference genome, published literature and best practices defined by the scientific community.
Illumina does not have an official recommendation for the level of sequencing coverage, but this technical note can help you estimating that coverage: Estimating Sequencing Coverage
This estimator helps with determining the reagents and sequencing runs that are needed to arrive at the desired coverage for your experiment: calculate sequencing coverage
The delivery times depends on the volume of samples to be processed and the type of analysis requested.
Do you have a specific deadline to meet? Contact us before submitting your project
The sequencing data obtained after MiSeq sequencing will be demultiplexed and delivered in FASTQ format. For single-read (SR) sequencing, only one FATSQ file will be created per sample (R1). For a paired-end (PE) analysis, two FASTQ files will be created per sample (R1 and R2). For more information on FASTQ files see the following Illumina bulletin: FASTQ files explained
Genotyping
The genotyping service includes the extraction of DNA from a mouse ear punch, a PCR reaction and a results report.
DNA is extracted by samples incubation in hot sodium hydroxide and pH adjustment with a Tris solution (HotSHOT method).
Reference : BioTechniques 29:52-54 (July 2000)
Mouse genotyping results are usually delivered within 48-72 hours following samples reception
Do you have a specific deadline to meet? Contact us


